A new high throughput sequencing assay for characterising the diversity of natural Vibrio communities and its application to a Pacific oyster mortality event - data analysis workflow

doi:10.17605/OSF.IO/4798P

Title	Authors

Home

The following data analysis workflow describes the analysis of short read *hsp60* amplicon sequences from environmental samples using the Vib-hspF3-23 and Vib-hspR401-422 primer pair. The associated publication is available at DOI: 10.3389/fmicb.2019.02907. https://www.frontiersin.org/articles/10.3389/fmicb.2019.02907/ ---------- Vib-hspF3-23: **TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG**GAACCCNATGGAYCTKAARCG Vib-hspR401-422: **GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG**GCVATGATHARHAGHGRRCGNG

OSF does not support the use of Internet Explorer. For optimal performance, please switch to another browser.

This website relies on cookies to help provide a better user experience. By clicking Accept or continuing to use the site, you agree. For more information, see our Privacy Policy and information on cookie use.

Start managing your projects on the OSF today.

Free and easy to use, the Open Science Framework supports the entire research lifecycle: planning, execution, reporting, archiving, and discovery.

Create an Account Learn More Hide this message

Main content

Home

Menu

Start managing your projects on the OSF today.

Main content

Links to this project

Home

Menu

Add new wiki page

Page permissions have changed

Wiki page deleted

Connected to the collaborative wiki

Connecting to the collaborative wiki

Collaborative wiki is unavailable

Browser unsupported

Start managing your projects on the OSF today.