MNase-seq of PCNA-NAQ assay MNase-seq was used to quantify nucleosome assembly in the PCNA-NAQ assay. In order to distinguish nicked and supercoiled DNA, we used two plasmids with different sequences: pRS415 and pLox3. After MNase inactivation a 207 bp DNA fragment was added as loading control in these experiments. Purified MNase-digested products (containing the loading control DNA) were used to prepare a Illumina sequencing library. First, samples were purified using the CleanNGS kit (GC biotech #CNGS-0008), according to the manufacturer’s protocol. Next, the CleanNGS elute was adjusted to 25ul with 10mM TRIS pH 7.5 and the ends of the digested DNA were repaired and phosphorylated at their 5’ end using the End-It DNA End-repair kit (Lucigen #ER0720). DNA was purified using MinElute PCR Purification Kit (QIAGEN #28006). Next, 3’A overhang were added to each fragment using the Klenow fragment (NEB #M0212M) and DNA was purified using MinElute PCR Purification Kit (QIAGEN #28006). Next, unique indexed DNA adapters (Supplementary Table S3) were ligated overnight at room temperature T4 DNA ligases (NEB # M0202L) to all fragments with A-overhangs and DNA was purified using MinElute PCR Purification Kit (QIAGEN #28006). Finally, all samples were amplified by a 8-cycle PCR-program using Phusion High-Fidelity DNA Polymerase (NEB #M0530L) using primers 5’- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT-3’and 5’- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTACACTCTTTCCCTACACGACGCTCTTCCGATCT-3’, prior to a final clean up using the MinElute Purification Kit (QIAGEN #28006). Samples were pooled with a total concentration of 100ng. The library was submitted for paired-end Illumina 150bp PE sequencing at Macrogen (Amsterdam). PCNA-NAQ-seq analysis was performed using custom scripts (https://github.com/deLaatLab/PCNA-NAQ-seq). The sequence data was demultiplexed by extracting reads that contained the ligated adapter index in both read ends and trimmed by removal of the 5’ adapter sequence from the reads. Demultiplexed reads were mapped against the pLox3, pRS415 and loading control DNA sequences using BWA mem v0.7.17 and filtered using samtools with SAM flag 780 and mapping quality 60 and saved as bam files. The bam files were imported in R and fragments mapping to pLox3 and pRS415 with fragment lengths between 125 and 160bp were selected for further analysis. The percentage of reads mapping to the nicked plasmid was calculated based on the total amount of reads found on both nicked and supercoiled plasmids. For coverage analysis pLox3 and pRS415 fragments were normalized for the total number of fragments mapping to the loading control sequence.